NEBuffer Activity/Performance Chart with Restriction Enzymes

NEB’s restriction enzyme buffer system makes your restriction digests easy and convenient. We are able to offer >210 restriction enzymes that cut in a single buffer, rCutSmart™ . This improves ease-of-use, especially when performing double digests. In addition to indicating the performance of each enzyme in the 4 NEBuffers, the chart also indicates ligation and recutting, star activity, and whether or not more than 1-site is required for cleavage.

Should you require information on performing restriction enzyme digestions, please refer to Optimizing Restriction Endonuclease Reactions.  You can also receive additional support by contacting [email protected].

We are excited to announce that all reaction buffers are now BSA-free. NEB began switching our BSA-containing reaction buffers in April 2021 to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. Find more details at


Not Sensitive
Impaired by Overlapping
Blocked by Overlapping
Impaired by Some Combinations of Overlapping
              Blocked by Some Combinations of Overlapping

Please check out other technical reference information related to restriction enzymes:
Double Digestion | Heat Inactivation | Activity at 37°C | Diluent Buffers | Time-Saver Enzymes | High Fidelity (HF) Restriction Enzymes 

Chart Notes | Icon Descriptions | Single Letter Code

Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
r1.1 r2.1 r3.1 rCutSmart
AatII     GACGT/C rCutSmart™ Buffer <10 50* 50 100 80°C 37°C B λ DNA
AbaSI   CNNNNNNNNNNN/NNNNNNNNNG rCutSmart™ Buffer 25 50 50 100 65°C 25°C C T4 wild-type phage DNA (fully ghmC-modified) e
AccI     GT/MKAC rCutSmart™ Buffer 50 50 10 100 80°C 37°C A λ DNA
Acc65I      G/GTACC NEBuffer™ r3.1 10 75* 100 25 65°C 37°C A pBC4 DNA
AciI     CCGC(-3/-1) rCutSmart™ Buffer <10 25 100 100 65°C 37°C A λ DNA
AclI     AA/CGTT rCutSmart™ Buffer <10 <10 <10 100 No 37°C B λ DNA
AcuI    CTGAAG(16/14) rCutSmart™ Buffer 50 100 50 100 65°C 37°C B λ DNA 1, b, d
AfeI    AGC/GCT rCutSmart™ Buffer 25 100 25 100 65°C 37°C B pXba DNA
AflII    C/TTAAG rCutSmart™ Buffer 50 100 10 100 65°C 37°C A ΦX174 RF I DNA
AflIII   A/CRYGT NEBuffer™ r3.1 10 50 100 50 80°C 37°C B λ DNA
AgeI-HF®      A/CCGGT rCutSmart™ Buffer 100 50 10 100 65°C 37°C A λ DNA
AhdI     GACNNN/NNGTC rCutSmart™ Buffer 25 25 10 100 65°C 37°C A λ DNA a
AleI-v2     CACNN/NNGTG rCutSmart™ Buffer <10 <10 <10 100 65°C 37°C B
AluI    AG/CT rCutSmart™ Buffer 25 100 50 100 80°C 37°C B λ DNA b
AlwI    GGATC(4/5) rCutSmart™ Buffer 50 50 10 100 No 37°C A λ DNA (dam-) 1, b, d
AlwNI     CAGNNN/CTG rCutSmart™ Buffer 10 100 50 100 80°C 37°C A λ DNA
ApaI      GGGCC/C rCutSmart™ Buffer 25 25 <10 100 65°C 37°C A pXba DNA
ApaLI     G/TGCAC rCutSmart™ Buffer 100 100 10 100 No 37°C A λ DNA (HindIII digest)
ApeKI     G/CWGC NEBuffer™ r3.1 25 50 100 10 No 75°C B λ DNA
ApoI §    R/AATTY NEBuffer™ r3.1 10 75 100 75 80°C 50°C A λ DNA
ApoI-HF     R/AATTY rCutSmart™ Buffer 10 100 10 100 80°C 37°C B λ DNA
AscI     GG/CGCGCC rCutSmart™ Buffer <10 10 10 100 80°C 37°C A λ DNA
AseI    AT/TAAT NEBuffer™ r3.1 <10 50* 100 10 65°C 37°C B λ DNA 3
AsiSI    GCGAT/CGC rCutSmart™ Buffer 100 100 25 100 80°C 37°C B XhoI digested pXba 2, b
AvaI     C/YCGRG rCutSmart™ Buffer <10 100 25 100 80°C 37°C A λ DNA
AvaII      G/GWCC rCutSmart™ Buffer 50 75 10 100 80°C 37°C A λ DNA
AvrII    C/CTAGG rCutSmart™ Buffer 100 50 50 100 No 37°C B λ DNA (HindIII digest)
BaeGI    GKGCM/C NEBuffer™ r3.1 75 75 100 25 80°C 37°C A λ DNA
BaeI     (10/15)ACNNNNGTAYC(12/7) rCutSmart™ Buffer 50 100 50 100 65°C 37°C A λ DNA e
BamHI §    G/GATCC NEBuffer™ r3.1 75* 100* 100 100* No 37°C A λ DNA 3
BamHI-HF®     G/GATCC rCutSmart™ Buffer 100 50 10 100 No 37°C A λ DNA
BanI     G/GYRCC rCutSmart™ Buffer 10 25 <10 100 65°C 37°C A λ DNA 1
BanII   GRGCY/C rCutSmart™ Buffer 100 100 50 100 80°C 37°C A λ DNA 2
BbsI §    GAAGAC(2/6) NEBuffer™ r2.1 100 100 25 75 65°C 37°C B λ DNA
BbsI-HF®     GAAGAC(2/6) rCutSmart™ Buffer 10 10 10 100 65°C 37°C B λ DNA
BbvCI    CCTCAGC(-5/-2) rCutSmart™ Buffer 10 100 50 100 No 37°C B λ DNA 1, a
BbvI    GCAGC(8/12) rCutSmart™ Buffer 100 100 25 100 65°C 37°C B pBR322 DNA 3
BccI   CCATC(4/5) rCutSmart™ Buffer 100 50 10 100 65°C 37°C A pXba DNA 3, b
BceAI    ACGGC(12/14) NEBuffer™ r3.1 100* 100* 100 100* 65°C 37°C A pBR322 DNA 1
BcgI     (10/12)CGANNNNNNTGC(12/10) NEBuffer™ r3.1 10 75* 100 50* 65°C 37°C A λ DNA e
BciVI    GTATCC(6/5) rCutSmart™ Buffer 100 25 <10 100 80°C 37°C C λ DNA b
BclI §     T/GATCA NEBuffer™ r3.1 50 100 100 75 No 50°C A λ DNA (dam-)
BclI-HF      T/GATCA rCutSmart™ Buffer 100 100 10 100 65°C 37°C B λ DNA (dam-)
BcoDI     GTCTC(1/5) rCutSmart™ Buffer 50 75 75 100 No 37°C B λ DNA
BfaI   C/TAG rCutSmart™ Buffer <10 10 <10 100 80°C 37°C B λ DNA 2, b
BfuAI     ACCTGC(4/8) NEBuffer™ r3.1 <10 25 100 10 65°C 50°C B λ DNA 3
BglI     GCCNNNN/NGGC NEBuffer™ r3.1 10 25 100 10 65°C 37°C B λ DNA
BglII    A/GATCT NEBuffer™ r3.1 10 10 100 <10 No 37°C A λ DNA
BlpI    GC/TNAGC rCutSmart™ Buffer 50 100 10 100 No 37°C A λ DNA d
BmgBI     CACGTC(-3/-3) NEBuffer™ r3.1 <10 10 100 10 65°C 37°C B λ DNA 3, b, d
BmrI   ACTGGG(5/4) NEBuffer™ r2.1 75 100 75 100* 65°C 37°C B λ DNA (HindIII digest) b
BmtI §   GCTAG/C NEBuffer™ r3.1 100 100 100 100+ 65°C 37°C B pXba DNA 2
BmtI-HF®     GCTAG/C rCutSmart™ Buffer 50 100 10 100 65°C 37°C B pXba DNA
BpmI   CTGGAG(16/14) NEBuffer™ r3.1 75 100 100 100* 65°C 37°C B λ DNA 2
BpuEI    CTTGAG(16/14) rCutSmart™ Buffer 50* 100 50* 100 65°C 37°C B λ DNA d
Bpu10I   CCTNAGC(-5/-2) NEBuffer™ r3.1 10 25 100 25 80°C 37°C B λ DNA 3, b, d
BsaAI     YAC/GTR rCutSmart™ Buffer 100 100 100 100 No 37°C C λ DNA
BsaBI     GATNN/NNATC rCutSmart™ Buffer 50 100 75 100 80°C 60°C B λ DNA (dam-) 2
BsaHI      GR/CGYC rCutSmart™ Buffer 50 100 100 100 80°C 37°C C λ DNA
BsaI-HF®v2       GGTCTC(1/5) rCutSmart™ Buffer 100 100 100 100 80°C 37°C B pXba DNA
BsaJI   C/CNNGG rCutSmart™ Buffer 50 100 100 100 80°C 60°C A λ DNA
BsaWI    W/CCGGW rCutSmart™ Buffer 10 100 50 100 80°C 60°C A λ DNA
BsaXI   (9/12)ACNNNNNCTCC(10/7) rCutSmart™ Buffer 50* 100* 10 100 No 37°C C λ DNA e
BseRI    GAGGAG(10/8) rCutSmart™ Buffer 100 100 75 100 80°C 37°C A λ DNA d
BseYI    CCCAGC(-5/-1) NEBuffer™ r3.1 10 50 100 50 80°C 37°C B λ DNA d
BsgI    GTGCAG(16/14) rCutSmart™ Buffer 25 50 25 100 65°C 37°C B λ DNA d
BsiEI     CGRY/CG rCutSmart™ Buffer 25 50 <10 100 No 60°C A λ DNA
BsiHKAI    GWGCW/C rCutSmart™ Buffer 25 100 100 100 No 65°C A λ DNA
BsiWI §     C/GTACG NEBuffer™ r3.1 25 50* 100 25 65°C 55°C B ΦX174 DNA
BsiWI-HF®      C/GTACG rCutSmart™ Buffer 50 100 10 100 No 37°C B ΦX174 DNA
BslI      CCNNNNN/NNGG rCutSmart™ Buffer 50 75 100 100 No 55°C A λ DNA b
BsmAI     GTCTC(1/5) rCutSmart™ Buffer 50 100 100 100 No 55°C B λ DNA
BsmBI-v2      CGTCTC NEBuffer™ r3.1 <10 50 100 25 80°C 55°C B
BsmFI     GGGAC(10/14) rCutSmart™ Buffer 25 50 50 100 80°C 65°C A pBR322 DNA 1
BsmI    GAATGC(1/-1) rCutSmart™ Buffer 25 100 <10 100 80°C 65°C A λ DNA
BsoBI    C/YCGRG rCutSmart™ Buffer 25 100 100 100 80°C 37°C A λ DNA
BspCNI    CTCAG(9/7) rCutSmart™ Buffer 100 75 10 100 80°C 37°C A λ DNA b
BspDI     AT/CGAT rCutSmart™ Buffer 25 75 50 100 80°C 37°C A λ DNA
BspEI      T/CCGGA NEBuffer™ r3.1 <10 10 100 <10 80°C 37°C B λ DNA (dam-)
BspHI     T/CATGA rCutSmart™ Buffer 10 50 25 100 80°C 37°C A λ DNA
Bsp1286I    GDGCH/C rCutSmart™ Buffer 25 25 25 100 65°C 37°C A λ DNA 3
BspMI   ACCTGC(4/8) NEBuffer™ r3.1 10 50* 100 10 65°C 37°C B λ DNA
BspQI    GCTCTTC(1/4) NEBuffer™ r3.1 100* 100* 100 100* 80°C 50°C B λ DNA 3
BsrBI     CCGCTC(-3/-3) rCutSmart™ Buffer 50 100 100 100 80°C 37°C A λ DNA d
BsrDI    GCAATG(2/0) NEBuffer™ r2.1 10 100 75 25 80°C 65°C A λ DNA 3, d
BsrFI-v2      R/CCGGY rCutSmart™ Buffer 25 25 0 100 No 37°C C pBR322 DNA
BsrGI §    T/GTACA NEBuffer™ r2.1 25 100 100 25 80°C 37°C A λ DNA
BsrGI-HF®     T/GTACA rCutSmart™ Buffer 10 100 100 100 80°C 37°C A λ DNA
BsrI   ACTGG(1/-1) NEBuffer™ r3.1 <10 50 100 10 80°C 65°C B ΦX174 DNA b
BssHII     G/CGCGC rCutSmart™ Buffer 100 100 100 100 65°C 50°C B λ DNA
BssSI-v2     CACGAG(-5/-1) rCutSmart™ Buffer 10 25 <10 100 No 37°C B λ DNA
BstAPI    GCANNNN/NTGC rCutSmart™ Buffer 50 100 25 100 80°C 60°C A λ DNA b
BstBI     TT/CGAA rCutSmart™ Buffer 75 100 10 100 No 65°C A λ DNA
BstEII  §    G/GTNACC NEBuffer™ r3.1 10 75* 100 75* No 60°C A λ DNA 3
BstEII-HF®     G/GTNACC rCutSmart™ Buffer <10 10 <10 100 No 37°C A λ DNA
BstNI    CC/WGG NEBuffer™ r3.1 10 100 100 75 No 60°C A λ DNA a
BstUI     CG/CG rCutSmart™ Buffer 50 100 25 100 No 60°C A λ DNA b
BstXI     CCANNNNN/NTGG NEBuffer™ r3.1 <10 50 100 25 80°C 37°C B λ DNA 3
BstYI    R/GATCY rCutSmart™ Buffer 25 100 75 100 No 60°C A λ DNA
BstZ17I-HF®      GTATAC rCutSmart™ Buffer 100 100 10 100 No 37°C A λ DNA
Bsu36I    CC/TNAGG rCutSmart™ Buffer 25 100 100 100 80°C 37°C C λ DNA (HindIII digest) b
BtgI    C/CRYGG rCutSmart™ Buffer 50 100 100 100 80°C 37°C B pBR322 DNA
BtgZI    GCGATG(10/14) rCutSmart™ Buffer 10 25 <10 100 80°C 60°C A λ DNA 3, b, d
BtsCI    GGATG(2/0) rCutSmart™ Buffer 10 100 25 100 80°C 50°C B λ DNA
BtsIMutI    CAGTG(2/0) rCutSmart™ Buffer 100 50 10 100 80°C 55°C A pUC19 DNA b
BtsI-v2     GCAGTG(2/0) rCutSmart™ Buffer 100 100 25 100 No 37°C A λ DNA 1
Cac8I    GCN/NGC rCutSmart™ Buffer 50 75 100 100 65°C 37°C B λ DNA b
ClaI      AT/CGAT rCutSmart™ Buffer 10 50 50 100 65°C 37°C A λ DNA (dam-)
CspCI    (11/13)CAANNNNNGTGG(12/10) rCutSmart™ Buffer 10 100 10 100 65°C 37°C A λ DNA e
CviAII    C/ATG rCutSmart™ Buffer 50 50 10 100 65°C 25°C C λ DNA
CviKI-1   RG/CY rCutSmart™ Buffer 25 100 100 100 No 37°C A pBR322 DNA 1, b
CviQI    G/TAC NEBuffer™ r3.1 75 100* 100 75* No 25°C C λ DNA b
DdeI    C/TNAG rCutSmart™ Buffer 75 100 100 100 65°C 37°C B λ DNA
DpnI     GA/TC rCutSmart™ Buffer 100 100 75 100 80°C 37°C B pBR322 DNA (dam methylated) b
DpnII     /GATC NEBuffer™ DpnII 25 25 100* 25 65°C 37°C B λ DNA (dam-)
DraI    TTT/AAA rCutSmart™ Buffer 75 75 50 100 65°C 37°C A λ DNA
DraIII-HF®      CACNNN/GTG rCutSmart™ Buffer <10 50 10 100 No 37°C B λ DNA b
DrdI     GACNNNN/NNGTC rCutSmart™ Buffer 25 50 10 100 65°C 37°C A pUC19 DNA 3
EaeI     Y/GGCCR rCutSmart™ Buffer 10 50 <10 100 65°C 37°C A λ DNA b
EagI-HF®      C/GGCCG rCutSmart™ Buffer 25 100 100 100 65°C 37°C B pXba DNA
EarI     CTCTTC(1/4) rCutSmart™ Buffer 50 10 <10 100 65°C 37°C B λ DNA b, d
EciI    GGCGGA(11/9) rCutSmart™ Buffer 100 50 50 100 65°C 37°C A λ DNA 2
Eco53kI     GAG/CTC rCutSmart™ Buffer 100 100 <10 100 65°C 37°C A pXba DNA 3, b
EcoNI    CCTNN/NNNAGG rCutSmart™ Buffer 50 100 75 100 65°C 37°C A λ DNA b
EcoO109I     RG/GNCCY rCutSmart™ Buffer 50 100 50 100 65°C 37°C A λ DNA (HindIII digest) 3
EcoP15I    CAGCAG(25/27) NEBuffer™ r3.1 + ATP 75 100 100 100 65°C 37°C A pUC19 DNA e
EcoRI §     G/AATTC NEBuffer™ EcoRI/SspI 25 100* 50 50* 65°C 37°C C λ DNA
EcoRI-HF®      G/AATTC rCutSmart™ Buffer 10 100 <10 100 65°C 37°C C λ DNA
EcoRV §     GAT/ATC NEBuffer™ r3.1 10 50 100 10 80°C 37°C A λ DNA
EcoRV-HF®      GAT/ATC rCutSmart™ Buffer 25 100 100 100 65°C 37°C B λ DNA
Esp3I     CGTCTC(1/5) rCutSmart™ Buffer 100 100 <10 100 65°C 37°C B λ DNA
FatI   /CATG NEBuffer™ r2.1 10 100 50 50 80°C 55°C A pUC19 DNA
FauI    CCCGC(4/6) rCutSmart™ Buffer 100 50 10 100 65°C 55°C A λ DNA 3, b, d
Fnu4HI     GC/NGC rCutSmart™ Buffer <10 <10 <10 100 No 37°C A λ DNA a
FokI     GGATG(9/13) rCutSmart™ Buffer 100 100 75 100 65°C 37°C A λ DNA 3, b, d
FseI      GGCCGG/CC rCutSmart™ Buffer 100 75 <10 100 65°C 37°C B pBC4 DNA
FspEI   CC(12/16) rCutSmart™ Buffer <10 <10 <10 100 80°C 37°C B pBR322 (dcm+) DNA 1, e
FspI     TGC/GCA rCutSmart™ Buffer 10 100 10 100 No 37°C C λ DNA b
HaeII     RGCGC/Y rCutSmart™ Buffer 25 100 10 100 80°C 37°C A λ DNA
HaeIII    GG/CC rCutSmart™ Buffer 50 100 25 100 80°C 37°C A λ DNA
HgaI    GACGC(5/10) NEBuffer™ r1.1 100 100 25 100* 65°C 37°C A ΦX174 DNA 1
HhaI     GCG/C rCutSmart™ Buffer 25 100 100 100 65°C 37°C A λ DNA
HincII     GTY/RAC rCutSmart™ Buffer 25 100 100 100 65°C 37°C B λ DNA
HindIII §   A/AGCTT NEBuffer™ r2.1 25 100 50 50 80°C 37°C B λ DNA 2
HindIII-HF®     A/AGCTT rCutSmart™ Buffer 10 100 10 100 80°C 37°C B λ DNA
HinfI     G/ANTC rCutSmart™ Buffer 50 100 100 100 80°C 37°C A λ DNA
HinP1I     G/CGC rCutSmart™ Buffer 100 100 100 100 65°C 37°C A λ DNA
HpaI    GTT/AAC rCutSmart™ Buffer <10 75* 25 100 No 37°C A λ DNA 1
HpaII     C/CGG rCutSmart™ Buffer 100 50 <10 100 80°C 37°C A λ DNA
HphI      GGTGA(8/7) rCutSmart™ Buffer 50 50 <10 100 65°C 37°C B λ DNA 1, b, d
HpyAV     CCTTC(6/5) rCutSmart™ Buffer 100 100 25 100 65°C 37°C λ DNA 3, b, d
HpyCH4III   ACN/GT rCutSmart™ Buffer 100 25 <10 100 65°C 37°C A λ DNA b
HpyCH4IV     A/CGT rCutSmart™ Buffer 100 50 25 100 65°C 37°C A pUC19 DNA
HpyCH4V    TG/CA rCutSmart™ Buffer 50 50 25 100 65°C 37°C A λ DNA
Hpy188I    TCN/GA rCutSmart™ Buffer 25 100 50 100 65°C 37°C A pBR322 DNA 1, b
Hpy99I    CGWCG/ rCutSmart™ Buffer 50 10 <10 100 65°C 37°C A λ DNA
Hpy166II     GTN/NAC rCutSmart™ Buffer 100 100 50 100 65°C 37°C C pBR322 DNA
Hpy188III     TC/NNGA rCutSmart™ Buffer 100 100 10 100 65°C 37°C B pUC19 DNA 3, b
I-CeuI   TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) rCutSmart™ Buffer 10 10 10 100 65°C 37°C B pBHS ScaI-linearized Control Plasmid
I-SceI   TAGGGATAACAGGGTAAT(-9/-13) rCutSmart™ Buffer 10 50 25 100 65°C 37°C B pGPS2 NotI-linearized Control Plasmid
KasI    G/GCGCC rCutSmart™ Buffer 50 100 50 100 65°C 37°C B pBR322 DNA 3
KpnI-HF®     GGTAC/C rCutSmart™ Buffer 100 25 <10 100 No 37°C A pXba DNA
LpnPI   CCDG(10/14) rCutSmart™ Buffer <10 <10 <10 100 65°C 37°C B pBR322 (dcm+) DNA 1, e
MboI      /GATC rCutSmart™ Buffer 75 100 100 100 65°C 37°C A λ DNA (dam-)
MboII     GAAGA(8/7) rCutSmart™ Buffer 100* 100 50 100 65°C 37°C C λ DNA (dam-) b
MfeI-HF®     C/AATTG rCutSmart™ Buffer 75 25 <10 100 No 37°C A λ DNA
MluCI    /AATT rCutSmart™ Buffer 100 10 10 100 No 37°C A λ DNA
MluI §     A/CGCGT NEBuffer™ r3.1 10 50 100 25 80°C 37°C A λ DNA
MluI-HF®      A/CGCGT rCutSmart™ Buffer 25 100 100 100 No 37°C A λ DNA
MlyI    GAGTC(5/5) rCutSmart™ Buffer 50 50 10 100 65°C 37°C A λ DNA b, d
MmeI     TCCRAC(20/18) rCutSmart™ Buffer 50 100 50 100 65°C 37°C B ΦX174 RF I DNA b, c
MnlI    CCTC(7/6) rCutSmart™ Buffer 75 100 50 100 65°C 37°C B λ DNA b
MscI    TGG/CCA rCutSmart™ Buffer 25 100 100 100 80°C 37°C C λ DNA
MseI    T/TAA rCutSmart™ Buffer 75 100 75 100 65°C 37°C A λ DNA
MslI    CAYNN/NNRTG rCutSmart™ Buffer 50 50 <10 100 80°C 37°C A λ DNA
MspA1I     CMG/CKG rCutSmart™ Buffer 10 50 10 100 65°C 37°C B λ DNA
MspI    C/CGG rCutSmart™ Buffer 75 100 50 100 No 37°C A λ DNA
MspJI   CNNR(9/13) rCutSmart™ Buffer <10 <10 <10 100 65°C 37°C B pBR322 (dcm+) DNA 1, e
MwoI     GCNNNNN/NNGC rCutSmart™ Buffer <10 100 100 100 No 60°C B λ DNA
NaeI    GCC/GGC rCutSmart™ Buffer 25 25 <10 100 No 37°C A pXba DNA b
NarI    GG/CGCC rCutSmart™ Buffer 100 100 10 100 65°C 37°C A pXba DNA
Nb.BbvCI   CCTCAGC rCutSmart™ Buffer 25 100 100 100 80°C 37°C A supercoiled plasmid DNA e
Nb.BsmI   GAATGC NEBuffer™ r3.1 <10 50 100 10 80°C 65°C A supercoiled plasmid pBR322 DNA e
Nb.BsrDI   GCAATG rCutSmart™ Buffer 25 100 100 100 80°C 65°C A supercoiled pUC19 DNA e
Nb.BssSI   CACGAG NEBuffer™ r3.1 10 100 100 25 No 37°C B supercoiled pUC19 DNA e
Nb.BtsI   GCAGTG rCutSmart™ Buffer 75 100 75 100 80°C 37°C A supercoiled pUC101 DNA (dam-/dcm-) e
NciI     CC/SGG rCutSmart™ Buffer 100 25 10 100 No 37°C A λ DNA b
NcoI §    C/CATGG NEBuffer™ r3.1 100 100 100 100+ 80°C 37°C A λ DNA
NcoI-HF®     C/CATGG rCutSmart™ Buffer 50 100 10 100 80°C 37°C B λ DNA
NdeI    CA/TATG rCutSmart™ Buffer 75 100 100 100 65°C 37°C A λ DNA
NgoMIV     G/CCGGC rCutSmart™ Buffer 100 50 10 100 No 37°C A pXba DNA 1
NheI-HF®      G/CTAGC rCutSmart™ Buffer 100 25 10 100 80°C 37°C C λ DNA (HindIII digest)
NlaIII    CATG/ rCutSmart™ Buffer <10 <10 <10 100 65°C 37°C B ΦX174 RF I DNA
NlaIV     GGN/NCC rCutSmart™ Buffer 10 10 10 100 65°C 37°C B pBR322 DNA
NmeAIII   GCCGAG(21/19) rCutSmart™ Buffer 10 10 <10 100 65°C 37°C B ΦX174 RF I DNA c
NotI §     GC/GGCCGC NEBuffer™ r3.1 <10 50 100 25 65°C 37°C C pBC4 DNA
NotI-HF®      GC/GGCCGC rCutSmart™ Buffer 25 100 25 100 65°C 37°C A pBC4 DNA
NruI §      TCG/CGA NEBuffer™ r3.1 <10 10 100 10 No 37°C A λ DNA b
NruI-HF®       TCG/CGA rCutSmart™ Buffer 0 25 50 100 No 37°C A λ DNA
NsiI §    ATGCA/T NEBuffer™ r3.1 10 75 100 25 65°C 37°C B λ DNA
NsiI-HF®     ATGCA/T rCutSmart™ Buffer <10 20 <10 100 80°C 37°C B λ DNA
NspI    RCATG/Y rCutSmart™ Buffer 100 100 <10 100 65°C 37°C A λ DNA
Nt.AlwI    GGATC(4/-5) rCutSmart™ Buffer 10 100 100 100 80°C 37°C A pUC101 DNA (dam-/dcm-) e
Nt.BbvCI    CCTCAGC(-5/-7) rCutSmart™ Buffer 50 100 10 100 80°C 37°C A supercoiled plasmid DNA e
Nt.BsmAI    GTCTC(1/-5) rCutSmart™ Buffer 100 50 10 100 65°C 37°C A supercoiled plasmid DNA e
Nt.BspQI   GCTCTTC(1/-7) NEBuffer™ r3.1 <10 25 100 10 80°C 50°C B supercoiled pUC19 DNA e
Nt.BstNBI   GAGTC(4/-5) NEBuffer™ r3.1 0 10 100 10 80°C 55°C A T7 DNA e
Nt.CviPII    (0/-1)CCD rCutSmart™ Buffer 10 100 25 100 65°C 37°C A pUC19 DNA e
PacI    TTAAT/TAA rCutSmart™ Buffer 100 75 10 100 65°C 37°C A pNEB193 DNA
PaeR7I     C/TCGAG rCutSmart™ Buffer 25 100 10 100 No 37°C A λ DNA (HindIII digest)
PaqCI    CACCTGC(4/8) rCutSmart™ Buffer 10 100 10 100 65°C 37°C B λ DNA 1
PciI   A/CATGT NEBuffer™ r3.1 50 75 100 50* 80°C 37°C B pXba DNA
PflFI    GACN/NNGTC rCutSmart™ Buffer 25 100 25 100 65°C 37°C A pBC4 DNA b
PflMI     CCANNNN/NTGG NEBuffer™ r3.1 0 100 100 50 65°C 37°C A λ DNA 3, b, d
PI-PspI   TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) NEBuffer™ PI-PspI + BSA 10 10 10 10 No 65°C B pAKR7 XmnI-linearized Control Plasmid
PI-SceI   ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) NEBuffer™ PI-SceI + BSA 10 10 10 10 65°C 37°C B pBSvdeX XmnI-linearized Control Plasmid
PleI    GAGTC(4/5) rCutSmart™ Buffer 25 50 25 100 65°C 37°C A λ DNA b, d
PluTI    GGCGC/C rCutSmart™ Buffer 100 25 <10 100 65°C 37°C A pXba DNA b
PmeI     GTTT/AAAC rCutSmart™ Buffer <10 50 10 100 65°C 37°C A λ DNA
PmlI     CAC/GTG rCutSmart™ Buffer 100 50 <10 100 65°C 37°C A λ DNA (HindIII digest) DNA
PpuMI     RG/GWCCY rCutSmart™ Buffer <10 <10 <10 100 No 37°C B λ DNA (HindIII digest)
PshAI     GACNN/NNGTC rCutSmart™ Buffer 25 50 10 100 65°C 37°C A λ DNA
PsiI-v2     TTA/TAA rCutSmart™ Buffer 25 50 10 100 65°C 37°C B λ DNA 3
PspGI    /CCWGG rCutSmart™ Buffer 25 100 50 100 No 75°C A T7 DNA 3
PspOMI     G/GGCCC rCutSmart™ Buffer 10 10 <10 100 65°C 37°C B pXba DNA
PspXI    VC/TCGAGB rCutSmart™ Buffer <10 100 25 100 No 37°C B λ DNA (HindIII digest)
PstI §    CTGCA/G NEBuffer™ r3.1 75 75 100 50* 80°C 37°C C λ DNA
PstI-HF®     CTGCA/G rCutSmart™ Buffer 10 75 50 100 No 37°C C λ DNA
PvuI §     CGAT/CG NEBuffer™ r3.1 <10 25 100 <10 No 37°C B pXba DNA
PvuI-HF®      CGAT/CG rCutSmart™ Buffer 25 100 100 100 No 37°C B pXba DNA
PvuII §    CAG/CTG NEBuffer™ r3.1 50 100 100 100* No 37°C B λ DNA
PvuII-HF®     CAG/CTG rCutSmart™ Buffer <10 <10 <10 100 No 37°C B λ DNA
RsaI     GT/AC rCutSmart™ Buffer 25 50 <10 100 No 37°C A λ DNA
RsrII    CG/GWCCG rCutSmart™ Buffer 25 75 10 100 65°C 37°C C λ DNA
SacI-HF®      GAGCT/C rCutSmart™ Buffer 10 50 <10 100 65°C 37°C A λ DNA (HindIII digest)
SacII     CCGC/GG rCutSmart™ Buffer 10 100 10 100 65°C 37°C A pXba DNA
SalI §     G/TCGAC NEBuffer™ r3.1 <10 <10 100 <10 65°C 37°C A λ DNA (HindIII digest)
SalI-HF®      G/TCGAC rCutSmart™ Buffer 10 100 100 100 65°C 37°C A λ DNA (HindIII digest)
SapI    GCTCTTC(1/4) rCutSmart™ Buffer 75 50 <10 100 65°C 37°C B λ DNA
Sau3AI    /GATC NEBuffer™ r1.1 100 50 10 100+ 65°C 37°C A λ DNA b
Sau96I     G/GNCC rCutSmart™ Buffer 50 100 100 100 65°C 37°C A λ DNA
SbfI-HF®     CCTGCA/GG rCutSmart™ Buffer 50 25 <10 100 80°C 37°C B λ DNA
ScaI-HF®     AGT/ACT rCutSmart™ Buffer 100 100 10 100 80°C 37°C B λ DNA
ScrFI     CC/NGG rCutSmart™ Buffer 100 100 100 100 65°C 37°C C λ DNA 2, a
SexAI    A/CCWGGT rCutSmart™ Buffer 100 75 50 100 65°C 37°C A pBC4 DNA (dcm-) 3, b, d
SfaNI    GCATC(5/9) NEBuffer™ r3.1 <10 75 100 25 65°C 37°C B ΦX174 RF I DNA 3, b
SfcI   C/TRYAG rCutSmart™ Buffer 75 50 25 100 65°C 37°C B λ DNA 3
SfiI      GGCCNNNN/NGGCC rCutSmart™ Buffer 25 100 50 100 No 50°C C pXba DNA
SfoI      GGC/GCC rCutSmart™ Buffer 50 100 100 100 No 37°C B λ DNA (HindIII digest)
SgrAI    CR/CCGGYG rCutSmart™ Buffer 100 100 10 100 65°C 37°C A λ DNA 1
SmaI     CCC/GGG rCutSmart™ Buffer <10 <10 <10 100 65°C 25°C B λ DNA (HindIII digest) b
SmlI   C/TYRAG rCutSmart™ Buffer 25 75 25 100 No 55°C A λ DNA b
SnaBI    TAC/GTA rCutSmart™ Buffer 50* 50 10 100 80°C 37°C A T7 DNA 1
SpeI-HF®     A/CTAGT rCutSmart™ Buffer 25 50 10 100 80°C 37°C C pXba-XbaI DNA
SphI §   GCATG/C NEBuffer™ r2.1 100 100 50 100+ 65°C 37°C B λ DNA 2
SphI-HF®     GCATG/C rCutSmart™ Buffer 50 25 10 100 65°C 37°C B λ DNA
SrfI     GCCC/GGGC rCutSmart™ Buffer 10 50 0 100 65°C 37°C B pNEB193-SrfI DNA
SspI §    AAT/ATT NEBuffer™ EcoRI/SspI 50 100 50 50 65°C 37°C C λ DNA
SspI-HF®     AAT/ATT rCutSmart™ Buffer 25 100 <10 100 65°C 37°C B λ DNA
StuI     AGG/CCT rCutSmart™ Buffer 50 100 50 100 No 37°C A λ DNA
StyD4I      /CCNGG rCutSmart™ Buffer 10 100 100 100 65°C 37°C B λ DNA
StyI-HF®     C/CWWGG rCutSmart™ Buffer 25 100 25 100 65°C 37°C A λ DNA
SwaI    ATTT/AAAT NEBuffer™ r3.1 10 10 100 10 65°C 25°C B pXba DNA b, d
TaqI-v2      T/CGA rCutSmart™ Buffer 50 100 50 100 No 65°C B λ DNA
TfiI     G/AWTC rCutSmart™ Buffer 50 100 100 100 No 65°C C λ DNA
TseI     G/CWGC rCutSmart™ Buffer 75 100 100 100 No 65°C B λ DNA 3
Tsp45I   /GTSAC rCutSmart™ Buffer 100 50 <10 100 No 65°C A λ DNA
TspMI    C/CCGGG rCutSmart™ Buffer 50* 75* 50* 100 No 75°C B pBC4 DNA d
TspRI    NNCASTGNN/ rCutSmart™ Buffer 25 50 25 100 No 65°C B λ DNA
Tth111I    GACN/NNGTC rCutSmart™ Buffer 25 100 25 100 No 65°C B pBC4 DNA b
WarmStart® Nt.BstNBI   GAGTC(4/-5) NEBuffer™ r3.1 0 10 100 25 80°C 55°C A T7 DNA
XbaI     T/CTAGA rCutSmart™ Buffer <10 100 75 100 65°C 37°C A λ DNA (dam-/Hind III digest)
XcmI   CCANNNNN/NNNNTGG NEBuffer™ r2.1 10 100 25 100* 65°C 37°C C λ DNA 2
XhoI     C/TCGAG rCutSmart™ Buffer 75 100 100 100 65°C 37°C A λ DNA (HindIII digest) b
XmaI     C/CCGGG rCutSmart™ Buffer 25 50 <10 100 65°C 37°C A pXba DNA 3
XmnI    GAANN/NNTTC rCutSmart™ Buffer 50 75 <10 100 65°C 37°C A λ DNA b
ZraI    GAC/GTC rCutSmart™ Buffer 100 25 10 100 80°C 37°C B λ DNA

§ An HF version of this enzyme is available.

The values listed in this table are approximate. They were obtained using each enzyme's specific unit assay substrate DNA. 

Ligation and Recutting Notes

The following notes appear with any enzymes having ligation efficiencies lower than 100% as assessed by ligation and recutting.

a. Ligation is less than 10%.
b. Ligation is 25% -75%.
c. Recutting after ligation is less than 5%.
d. Recutting after ligation is 50% -75%.
e. Ligation and recutting after ligation is not applicable since the enzyme is either a nicking enzyme, is affected by methylation, or if the enzyme cleaves outside its recognition sequence.

Star Activity Notes

The following notes appear with any enzymes when star activity is a concern.

1. Star Activity may result from extended digestion, high enzyme concentration or a glycerol concentration of > 5%.
2. Star Activity may result from extended digestion.
3. Star Activity may result from a glycerol concentration of > 5%.
*. May exhibit star activity in this buffer.
+. For added flexibility, NEB offers an isoschizomer or HF enzyme, supplied with CutSmart Buffer.

Loading Spinner